Oligonucleotides

Thermo Scientific™ Primers for cDNA Synthesis

Optimze cDNA synthesis with these random hexamer primers, oligo(dT)18 primers and anchored oligo dT primers. 120 UL RANDOM HEXAMER PRIMER, 100µM 120µL STOREat -20°C

Pricing and Availability

Invitrogen™ Oligo(dT) 12-18 Primer

Primer is suitable for use in first-strand cDNA synthesis with reverse transcriptase Oligo(dT)12 18 Primer, 25 µg

Pricing and Availability

Applied Biosystems™ Random Hexamers (50mM)

Serve as primers for DNA synthesis by a DNA polymerase or reverse transcriptase 1 SET Random Hexamers (50um) 1kit Store at -20 C

Pricing and Availability

Applied Biosystems™ 5' Fluorescent Labeled Single Primers

Custom 5' labeled primers are fluorescently labeled oligos with a choice of dye on the 5' end TA PCRII DUAL PROMOTER

Pricing and Availability

Thermo Scientific™ M13/pUC sequencing primer (-20), 17-mer

Accurately sequence DNA with M13 pUC sequencing primers, single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends. 6 NMOL M13/PUC SEQUENCING PRIMER (-20), 17-MER,5'-d(GTAAAACGACGGCCAGT)-3', 10µm, 6nmol Store at

Pricing and Availability

Invitrogen™ M13 Reverse

Oligonucleotides complementary to a DNA template are necessary to prime DNA synthesis for sequencing reactions 2UG PRIM,M13 REVERSE

Pricing and Availability

Thermo Scientific™ Transcription Promoter Sequencing Primers

Perform sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II. SP6 PRIM 24-MER 10UM 4.2NMOL

Pricing and Availability

Thermo Scientific™ Transcription Promoter Sequencing Primers

Perform sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II. T7 PRIMER 20-MER 10UM 5NMOL

Pricing and Availability

Invitrogen™ T7 Promoter Primer

Primers for PCR amplification that complement many vectors PRIMER, T7Invitrogen offers primers for PCR amplification

Pricing and Availability

Thermo Scientific™ Transcription Promoter Sequencing Primers

Perform sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II. T3 PRIMER 24-MER 10UM 4.2NMOL

Pricing and Availability

Invitrogen™ Anchored Oligo(dT) 20 Primer

Primer mixture consisting of a string of 20 deoxythymidylic acid residues followed by dV (either dG, dA, or dC) and then by dN (dA, dT, dG, or dC) ANCHORED OLIGO(DT) 20 PRIM50UG

Pricing and Availability

Invitrogen™ M13 Forward (-20)

Oligonucleotides complementary to a DNA template are necessary to prime DNA synthesis for sequencing reactions 2UG PRIM,M13(-20)FORWARD

Pricing and Availability

Thermo Scientific™ M13/pUC reverse sequencing primer (-46), 24-mer

Sequence DNA fragments inserted into the MCS of various pUC19 based cloning vectors with M13 pUC sequencing primers, single-stranded oligonucleotides. M13/PUC REV -46 10UM 4.2NMOL

Pricing and Availability

Thermo Scientific™ M13/pUC sequencing primer (-46), 22-mer

Sequence DNA fragments inserted into the MCS of various pUC19 based cloning vectors with M13 pUC sequencing primers, single-stranded oligonucleotides. M13/PUC PRIM -46 10UM 4.5NMOL

Pricing and Availability

Invitrogen™ RNA Century™-Plus Marker Templates

Contain mixtures of linearized plasmids ready for use as templates during in vitro transcription reactions for synthesis of labeled RNA molecular size standards 5 UG CENTURY-PLUS MARKER TEMPLATES 5µG STORE AT-20 C

Pricing and Availability

Thermo Scientific™ pJET1.2 Sequencing Primers

Primers for sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2 and for colony screening by PCR. PJET1.2 REVERSE SEQUENCING PRIMER, 24-MER, 5'-D(AAGAACATCGATTTTCCATGGCAG)-3', 10µm, 8.4nmol Store

Pricing and Availability

Invitrogen™ 5-(3-Aminoallyl)-UTP (50mM)

Ambion Modified nucleotides confer unique characteristics to the RNA molecules into which they are incorporated 50MM 5-(3-AMINOALLYL)-UTP 50ULAmbion® Modified nucleotides confer unique

Pricing and Availability

Invitrogen™ Random Decamers (50μM)

Provided at a stock concentration of 50μM, and functionally tested using the RETROscript™ Kit 80 UL RANDOM DECAMERS (50 UM) 80µL STORE AT -20 C

Pricing and Availability

Thermo Scientific™ M13/pUC reverse sequencing primer (-26), 17-mer

Sequence DNA fragments inserted into the MCS of various pUC19-based cloning vectors with M13 pUC sequencing primers, single-stranded oligonucleotides. 6 NMOL M13/PUC REVERSE SEQUENCING PRIMER (-26),17-mer 5'-d(CAGGAAACAGCTATGAC)-3', 10µm, 6nmol

Pricing and Availability

Thermo Scientific™ Oligo(dT)18 Primers

Thermo Scientific™ Oligo(dT)18 Primer is a synthetic single-stranded 18-mer oligonucleotide with 5'- and 3'-hydroxyl ends. 120 UL OLIGO(DT)18 PRIMER, 100µM 120µL STORE AT-20°C

Pricing and Availability

Invitrogen™ RNA Century™ Marker Templates

Contain mixtures of linearized plasmids ready for use as templates as part of in vitro transcription reactions for synthesis of labeled RNA molecular size standards 5 UG CENTURY MARKER TEMPLATES 5µG STORE AT -20 C

Pricing and Availability

Thermo Scientific™ M13/pUC sequencing primer (-40), 17-mer

Sequence DNA fragments inserted into the MCS of various pUC19 based cloning vectors with M13 pUC sequencing primers, single-stranded oligonucleotides. 6 NMOL M13/PUC SEQUENCING PRIMER (-40), 17-MER,5'-d(GTTTTCCCAGTCACGAC)-3', 10µm, 6nmol Store at

Pricing and Availability

Invitrogen™ Bio-16-UTP (10mM)

Ideal for use as substrates as part of in vitro transcription reactions 25 UL BIO-16-UTP 25µL STORE AT -80°C

Pricing and Availability

Invitrogen™ Bio-11-UTP (75mM)

Ideal for use as substrates as part of in vitro transcription reactions 30 UL BIO-11-UTP 30µL STORE AT -80°C

Pricing and Availability

Thermo Scientific™ Exo-Resistant Random Primer

Perform highly efficient random priming of DNA synthesis reactions with this mixture of single-stranded random oligonucleotides. 100 UL EXO-RESISTANT RANDOM PRIMER, 5'-NPNPNPNPNPSNpSN-3', 500µm 100µL Store at -20°C

Pricing and Availability

Invitrogen™ Random Primers

Truly random primers suitable for DNA synthesis using Klenow fragments with DNA templates or for cDNA synthesis using reverse transcriptase with mRNA templates RANDOM PRIMERS,1.5MM 9 units

Pricing and Availability

Thermo Scientific™ Transcription Promoter Sequencing Primers

Perform sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II. SP6 PRIM 18-MER 10UM 5.6 NMOL

Pricing and Availability

Invitrogen™ Bio-11-UTP (10mM)

Ideal for use as substrates as part of in vitro transcription reactions 25 UL BIO-11-UTP 25µL STORE AT -80°C

Pricing and Availability

Invitrogen™ Lambda Hind III dsDNA Markers

Ambion Lambda DNA is digested to completion with Hind III 0.5 MG LAMBDA DNA - HIND III DIGESTED 0.5MG STOREat -20°C

Pricing and Availability

Invitrogen™ 5-(3-Aminoallyl)-dUTP (50mM)

When incorporated into DNA, 5-(3-aminoallyl)-dUTP provides a reactive group for addition of other chemical groups 50MM 5-(3-AMINOALLYL)-UTP 5ULAmbion® Modified nucleotides confer unique

Pricing and Availability

One moment while we fetch your results  spinner