Truly random primers suitable for DNA synthesis using Klenow fragments with DNA templates or for cDNA synthesis using reverse transcriptase with mRNA templates RANDOM PRIMERS,1.5MM 9 units

Primer is suitable for use in first-strand cDNA synthesis with reverse transcriptase Oligo(dT)12 18 Primer, 25 µg

Optimze cDNA synthesis with these random hexamer primers, oligo(dT)₁₈ primers and anchored oligo dT primers. 120 UL RANDOM HEXAMER PRIMER, 100µM 120µL STOREat -20°C

Serve as primers for DNA synthesis by a DNA polymerase or reverse transcriptase 1 SET Random Hexamers (50um) 1kit Store at -20 C

Thermo Scientific™ Oligo(dT)₁₈ Primer is a synthetic single-stranded 18-mer oligonucleotide with 5'- and 3'-hydroxyl ends. 60 UL OLIGO(DT)18 PRIMER, 100µM 60µL STORE AT-20°C

Used for first-strand cDNA synthesis with reverse transcriptase at temperatures of ≥50°C OLIGO DT(20) PRIMER

Custom 5' labeled primers are fluorescently labeled oligos with a choice of dye on the 5' end TA PCRII DUAL PROMOTER

Oligonucleotides complementary to a DNA template are necessary to prime DNA synthesis for sequencing reactions 2UG PRIM,M13(-20)FORWARD

Sequence DNA fragments inserted into the MCS of various pUC19-based cloning vectors with M13 pUC sequencing primers, single-stranded oligonucleotides. 6 NMOL M13/PUC REVERSE SEQUENCING PRIMER (-26),17-mer 5'-d(CAGGAAACAGCTATGAC)-3', 10µm, 6nmol

Perform highly efficient random priming of DNA synthesis reactions with this mixture of single-stranded random oligonucleotides. 100 UL EXO-RESISTANT RANDOM PRIMER, 5'-NPNPNPNPNPSNpSN-3', 500µm 100µL Store at -20°C

Primer mixture consisting of a string of 20 deoxythymidylic acid residues followed by dV (either dG, dA, or dC) and then by dN (dA, dT, dG, or dC) ANCHORED OLIGO(DT) 20 PRIM50UG

Provided at a stock concentration of 50μM 80 UL OLIGO (DT) PRIMER (50 UM) 80µL STORE AT-20°C

Template primers POLY (A) 100 MG

Used for priming and reverse transcription of polyadenylated (poly A+) mRNA OLIGO D(T)16 PRIMERApplied Biosystems® Oligo d(T)16 is a

Provided at a stock concentration of 50μM, and functionally tested using the RETROscript™ Kit 80 UL RANDOM DECAMERS (50 UM) 80µL STORE AT -20 C

Contain mixtures of linearized plasmids ready for use as templates as part of in vitro transcription reactions for synthesis of labeled RNA molecular size standards 5 UG CENTURY MARKER TEMPLATES 5µG STORE AT -20 C

Perform sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II. T3 PRIMER 17-MER 10UM 6NMOL

Perform sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II. T3 PRIMER 24-MER 10UM 4.2NMOL

When incorporated into DNA, 5-(3-aminoallyl)-dUTP provides a reactive group for addition of other chemical groups 50MM 5-(3-AMINOALLYL)-UTP 5ULAmbion® Modified nucleotides confer unique

Ambion Modified nucleotides confer unique characteristics to the RNA molecules into which they are incorporated 50MM 5-(3-AMINOALLYL)-UTP 50ULAmbion® Modified nucleotides confer unique

Sequence DNA fragments inserted into the MCS of various pUC19 based cloning vectors with M13 pUC sequencing primers, single-stranded oligonucleotides. M13/PUC REV -46 10UM 4.2NMOL

Sequence DNA fragments inserted into the MCS of various pUC19 based cloning vectors with M13 pUC sequencing primers, single-stranded oligonucleotides. 6 NMOL M13/PUC SEQUENCING PRIMER (-40), 17-MER,5'-d(GTTTTCCCAGTCACGAC)-3', 10µm, 6nmol Store at

Primers for sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2 and for colony screening by PCR. PJET1.2 FORWARD SEQUENCING PRIMER, 23-MER, 5'-D(CGACTCACTATAGGGAGAGCGGC)-3, 10µm, 8.7nmol Store at

Primers for PCR amplification that complement many vectors PRIMER, T7Invitrogen offers primers for PCR amplification

Ambion Lambda DNA is digested to completion with Hind III 0.5 MG LAMBDA DNA - HIND III DIGESTED 0.5MG STOREat -20°C

Perform sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II. SP6 PRIM 18-MER 10UM 5.6 NMOL

Oligonucleotides complementary to a DNA template are necessary to prime DNA synthesis for sequencing reactions 2UG PRIM,M13 REVERSE

Ideal for use as substrates as part of in vitro transcription reactions 30 UL BIO-11-UTP 30µL STORE AT -80°C

Ambion pUC 19 DNA is digested to completion with Sau3A I 0.5 MG PUC19 DNA - SAU3A I DIGESTED 0.5MG STOREat -20 C

Perform sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II. SP6 PRIM 24-MER 10UM 4.2NMOL